The password is mpiblast
Feel free to edit this page by asking more questions, adding new insight, or restructuring what is here.
Ignore that hyperlinks, (ie blastall). This seems to be an unavoidable limitation of pbwiki vs the blast output format at the moment.
Bugs
These two sequences differ by only a single nucleotide (at the 3rd position)
figur@burns:~/webfigur.run/jobs/test1$ more seq.warn
>gi49476684ref~NC_005957.1from=4172686
TTTGCTTCTTCTTCAGCTTTTTTCTGTTCTTCTTCAGCCTTTAGCTTCTCTTCTTCTTCT
TCTTCTTTCTTCTTAGCCTCTGTTTTCTCTTGTTCATTCTTCTTCGTCTCTTCTTTTCCT
TT
figur@burns:~/webfigur.run/jobs/test1$ more seq.error
>gi49476684refNC_005957.1|from=4172686
TTCGCTTCTTCTTCAGCTTTTTTCTGTTCTTCTTCAGCCTTTAGCTTCTCTTCTTCTTCT
TCTTCTTTCTTCTTAGCCTCTGTTTTCTCTTGTTCATTCTTCTTCGTCTCTTCTTTTCCT
TT
Neither should return any hits for most databases.
The first sequence throws some warnings.
figur@burns:~/webfigur.run/jobs/test1$ more blast.latest.warn.err
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
While the later sequence crashes harder
figur@burns:~/webfigur.run/jobs/test1$ more blast.latest.err.err
blastall WARNING: [000.000] gi49476684refNC_005957.1from=4172686: SetUpBlastSearch failed.
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall WARNING: [000.000] lcltmpseq_0: SetUpBlastSearch failed.
blastall WARNING: [000.000] lcltmpseq_0: SetUpBlastSearch failed.
blastall WARNING: [000.000] lcltmpseq_0: SetUpBlastSearch failed.
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall WARNING: [000.000] lcltmpseq_0: SetUpBlastSearch failed.
blastall WARNING: [000.000] gi49476684refNC_005957.1from=4172686: SetUpBlastSearch failed.
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcltmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
During this crash it fails to put the footer on the blast report.
I've repeated this for a different, smaller blastable database with identical effect.
mpiblast was started as:
/usr/bin/mpirun.mpich -machinefile /home/figur/figure/src/../config/lamhosts -np 6 /mnt/figur/shared/mpiblast/mpiblast -p blastn -d nt --disable-mpi-db -b 10000 -v 10000 -I T -o blast.out -i seq
Building from source
Here is the procedure I used to build mpiblast from source
apt-get install automake1.9
tar zxvf mpiblast-latest.tar.gz
tar zxvf ncbi.tar.gz
patch -p0 < mpiblast/ncbi_Oct2004_evalue.patch
ncbi/make/makedis.csh
cd mpiblast
aclocal
autoheader
automake -a
autoconf
./configure --with-ncbi=/full/path/to/ncbi
make
Comments (0)
You don't have permission to comment on this page.