The password is mpiblast
Bugs
These two sequences differ by only a single nucleotide (at the 3rd position)
figur@burns:~/webfigur.run/jobs/test1$ more seq.warn
>gi49476684ref~NC_005957.1from=4172686
TTTGCTTCTTCTTCAGCTTTTTTCTGTTCTTCTTCAGCCTTTAGCTTCTCTTCTTCTTCT
TCTTCTTTCTTCTTAGCCTCTGTTTTCTCTTGTTCATTCTTCTTCGTCTCTTCTTTTCCT
TT
figur@burns:~/webfigur.run/jobs/test1$ more seq.error
>gi49476684refNC_005957.1|from=4172686
TTCGCTTCTTCTTCAGCTTTTTTCTGTTCTTCTTCAGCCTTTAGCTTCTCTTCTTCTTCT
TCTTCTTTCTTCTTAGCCTCTGTTTTCTCTTGTTCATTCTTCTTCGTCTCTTCTTTTCCT
TT
Neither should return any hits for most databases.
The first sequence throws some warnings.
figur@burns:~/webfigur.run/jobs/test1$ more blast.latest.warn.err
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
blastall WARNING: [000.000] lcltmpseq_0: Blast: No valid letters to be indexed on context 0
While the later sequence crashes harder
figur@burns:~/webfigur.run/jobs/test1$ more blast.latest.err.err
blastall WARNING: [000.000] gi49476684refNC_005957.1from=4172686: SetUpBlastSearch failed.
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall WARNING: [000.000] lcl|tmpseq_0: SetUpBlastSearch failed.
blastall WARNING: [000.000] lcl|tmpseq_0: SetUpBlastSearch failed.
blastall WARNING: [000.000] lcl|tmpseq_0: SetUpBlastSearch failed.
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall WARNING: [000.000] lcl|tmpseq_0: SetUpBlastSearch failed.
blastall WARNING: [000.000] gi49476684refNC_005957.1from=4172686: SetUpBlastSearch failed.
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] gi49476684refNC_005957.1from=4172686: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
blastall ERROR: [000.000] lcl|tmpseq_0: BLASTSetUpSearch: Unable to calculate Karlin-Altschul params, check query sequence
During this crash it fails to put the footer on the blast report
Building from source
apt-get install automake1.9
tar zxvf mpiblast-latest.tar.gz
tar zxvf ncbi.tar.gz
patch -p0 < mpiblast/ncbi_Oct2004_evalue.patch
ncbi/make/makedis.csh
cd mpiblast
aclocal
autoheader
automake -a
autoconf
./configure --with-ncbi=/full/path/to/ncbi
make
Comments (0)
You don't have permission to comment on this page.